bio-workflows-clip-pipeline
CLIP-seq Pipeline
Pipeline Overview
FASTQ → QC → UMI extract → Trim adapters → Align → Filter → Dedup → Peak call → Annotate → Motifs
CLIP Method Variants
| Method | UMI | Crosslink Site | Adapter |
|---|---|---|---|
| HITS-CLIP | Optional | Deletions | 3' adapter |
| PAR-CLIP | Optional | T→C mutations | 3' adapter |
| iCLIP | Required | 5' of read | 3' adapter |
| eCLIP | Required | 5' of read | 3' adapter |
Step 1: Quality Control
# Initial QC
fastqc reads.fastq.gz -o qc_pre/
# Check for adapter contamination and UMI structure
# For eCLIP: expect 10nt UMI at read start
zcat reads.fastq.gz | head -n 100 | cut -c1-15
Step 2: UMI Extraction
# eCLIP (10nt UMI at 5' end)
umi_tools extract \
--stdin=reads.fastq.gz \
--bc-pattern=NNNNNNNNNN \
--stdout=extracted.fastq.gz \
--log=umi_extract.log
# iCLIP (5nt experimental barcode + 5nt UMI)
umi_tools extract \
--stdin=reads.fastq.gz \
--bc-pattern=NNNNNXXXXX \
--stdout=extracted.fastq.gz
Step 3: Adapter Trimming
# Trim 3' adapter (common eCLIP adapter)
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
--minimum-length 20 \
--quality-cutoff 20 \
-o trimmed.fastq.gz \
extracted.fastq.gz
# For paired UMI adapters
cutadapt -a AGATCGGAAGAGCACACGTCT \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
--minimum-length 20 \
-o trimmed_R1.fq.gz -p trimmed_R2.fq.gz \
extracted_R1.fq.gz extracted_R2.fq.gz
Step 4: Alignment
# Build STAR index (once)
STAR --runMode genomeGenerate \
--genomeDir star_index \
--genomeFastaFiles genome.fa \
--sjdbGTFfile genes.gtf \
--sjdbOverhang 100
# Align with STAR (optimized for short CLIP reads)
STAR --genomeDir star_index \
--readFilesIn trimmed.fastq.gz \
--readFilesCommand zcat \
--outFilterMismatchNmax 2 \
--outFilterMultimapNmax 1 \
--outSAMtype BAM SortedByCoordinate \
--outSAMattributes All \
--alignEndsType EndToEnd \
--outFileNamePrefix clip_
Step 5: Alignment Filtering
# Remove unmapped and low-quality reads
samtools view -b -F 4 -q 10 clip_Aligned.sortedByCoord.out.bam > filtered.bam
samtools index filtered.bam
# Optional: remove reads mapping to rRNA/tRNA
bedtools intersect -v -abam filtered.bam -b rrna_trna.bed > filtered_norRNA.bam
Step 6: PCR Deduplication
# UMI-aware deduplication
umi_tools dedup \
-I filtered.bam \
-S dedup.bam \
--output-stats=dedup_stats
samtools index dedup.bam
# Check deduplication rate
echo "Duplication rate:" $(grep "Input Reads" dedup_stats.log | awk '{print $3}')
Step 7: Peak Calling
# CLIPper (recommended)
clipper -b dedup.bam -s hg38 -o peaks.bed --FDR 0.05 --superlocal
# Alternative: Piranha
Piranha -s dedup.bam -o piranha_peaks.bed -p 0.01
# For PAR-CLIP with T→C mutations
PARalyzer settings.ini
# Strand-specific calling
samtools view -h -F 16 dedup.bam | samtools view -Sb - > plus.bam
samtools view -h -f 16 dedup.bam | samtools view -Sb - > minus.bam
clipper -b plus.bam -s hg38 -o peaks_plus.bed
clipper -b minus.bam -s hg38 -o peaks_minus.bed
cat peaks_plus.bed peaks_minus.bed | sort -k1,1 -k2,2n > peaks_stranded.bed
Step 8: Peak Annotation
# Annotate with gene features
bedtools intersect -a peaks.bed -b genes.gtf -wo > peaks_annotated.txt
# Or use HOMER
annotatePeaks.pl peaks.bed hg38 > peaks_homer_annotated.txt
# Feature distribution
awk -F'\t' '{print $8}' peaks_homer_annotated.txt | sort | uniq -c | sort -rn
Step 9: Motif Analysis
# Extract peak sequences
bedtools getfasta -fi genome.fa -bed peaks.bed -s -fo peaks.fa
# HOMER motif finding (RNA mode)
findMotifs.pl peaks.fa fasta motif_output -rna -len 5,6,7,8 -p 8
# MEME-ChIP
meme-chip -oc meme_output -dna peaks.fa -meme-mod zoops -meme-nmotifs 10
Step 10: Cross-link Site Analysis
# For iCLIP/eCLIP: identify crosslink sites (read 5' ends)
bedtools genomecov -ibam dedup.bam -bg -5 -strand + > crosslinks_plus.bg
bedtools genomecov -ibam dedup.bam -bg -5 -strand - > crosslinks_minus.bg
# For PAR-CLIP: identify T→C conversion sites
# Requires specialized tools like PARpipe
Quality Checkpoints
| Step | Metric | Expected |
|---|---|---|
| Raw | Read count | >10M |
| Trimmed | Reads >20bp | >80% |
| Aligned | Mapping rate | >50% |
| Dedup | Unique rate | >20% |
| Peaks | Peak count | 1,000-50,000 |
| Peaks | Median width | 20-100 nt |
| FRiP | Reads in peaks | >10% |
# Calculate FRiP
reads_in_peaks=$(bedtools intersect -a dedup.bam -b peaks.bed -u | samtools view -c -)
total_reads=$(samtools view -c dedup.bam)
frip=$(echo "scale=4; $reads_in_peaks / $total_reads" | bc)
echo "FRiP: $frip"
Complete Pipeline Script
#!/bin/bash
set -euo pipefail
SAMPLE=$1
READS=$2
GENOME_DIR=$3
GENOME_FA=$4
mkdir -p qc trimmed aligned peaks motifs
# QC
fastqc $READS -o qc/
# UMI extract
umi_tools extract --stdin=$READS --bc-pattern=NNNNNNNNNN \
--stdout=trimmed/${SAMPLE}_extracted.fq.gz
# Trim
cutadapt -a AGATCGGAAGAGCACACGTCT --minimum-length 20 \
-o trimmed/${SAMPLE}_trimmed.fq.gz trimmed/${SAMPLE}_extracted.fq.gz
# Align
STAR --genomeDir $GENOME_DIR --readFilesIn trimmed/${SAMPLE}_trimmed.fq.gz \
--readFilesCommand zcat --outFilterMismatchNmax 2 --outFilterMultimapNmax 1 \
--outSAMtype BAM SortedByCoordinate --outFileNamePrefix aligned/${SAMPLE}_
# Filter and dedup
samtools view -b -F 4 -q 10 aligned/${SAMPLE}_Aligned.sortedByCoord.out.bam | \
samtools sort -o aligned/${SAMPLE}_filtered.bam
samtools index aligned/${SAMPLE}_filtered.bam
umi_tools dedup -I aligned/${SAMPLE}_filtered.bam -S aligned/${SAMPLE}_dedup.bam
samtools index aligned/${SAMPLE}_dedup.bam
# Peaks
clipper -b aligned/${SAMPLE}_dedup.bam -s hg38 -o peaks/${SAMPLE}_peaks.bed
# Motifs
bedtools getfasta -fi $GENOME_FA -bed peaks/${SAMPLE}_peaks.bed -s -fo peaks/${SAMPLE}.fa
findMotifs.pl peaks/${SAMPLE}.fa fasta motifs/${SAMPLE} -rna -len 5,6,7 -p 4
echo "Pipeline complete for $SAMPLE"
Related Skills
- clip-seq/clip-preprocessing - Detailed preprocessing
- clip-seq/clip-alignment - Alignment optimization
- clip-seq/clip-peak-calling - Peak caller comparison
- clip-seq/binding-site-annotation - Feature annotation
- clip-seq/clip-motif-analysis - Motif discovery
More from gptomics/bioskills
bioskills
Installs 425 bioinformatics skills covering sequence analysis, RNA-seq, single-cell, variant calling, metagenomics, structural biology, and 56 more categories. Use when setting up bioinformatics capabilities or when a bioinformatics task requires specialized skills not yet installed.
100bio-single-cell-batch-integration
Integrate multiple scRNA-seq samples/batches using Harmony, scVI, Seurat anchors, and fastMNN. Remove technical variation while preserving biological differences. Use when integrating multiple scRNA-seq batches or datasets.
5bio-epitranscriptomics-merip-preprocessing
Align and QC MeRIP-seq IP and input samples for m6A analysis. Use when preparing MeRIP-seq data for peak calling or differential methylation analysis.
5bio-data-visualization-multipanel-figures
Combine multiple plots into publication-ready multi-panel figures using patchwork, cowplot, or matplotlib GridSpec with shared legends and panel labels. Use when combining multiple plots into publication figures.
5bio-data-visualization-specialized-omics-plots
Reusable plotting functions for common omics visualizations. Custom ggplot2/matplotlib implementations of volcano, MA, PCA, enrichment dotplots, boxplots, and survival curves. Use when creating volcano, MA, or enrichment plots.
5bio-read-qc-fastp-workflow
All-in-one read preprocessing with fastp including adapter trimming, quality filtering, deduplication, base correction, and HTML report generation. Use when preprocessing Illumina data and wanting a single fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps.
5