bio-read-qc-fastp-workflow
fastp Workflow
All-in-one preprocessing tool that handles adapter trimming, quality filtering, deduplication, and report generation in a single pass.
Basic Usage
Single-End
fastp -i input.fastq.gz -o output.fastq.gz
Paired-End
fastp -i R1.fastq.gz -I R2.fastq.gz -o R1_clean.fastq.gz -O R2_clean.fastq.gz
With Custom HTML/JSON Reports
fastp -i R1.fq.gz -I R2.fq.gz \
-o R1_clean.fq.gz -O R2_clean.fq.gz \
-h sample_report.html \
-j sample_report.json
Adapter Trimming
fastp auto-detects Illumina adapters by default.
# Auto-detect (default)
fastp -i in.fq -o out.fq
# Specify adapters manually
fastp -i in.fq -o out.fq \
--adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
# Paired-end with manual adapters
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \
--adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
--adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
# Disable adapter trimming
fastp -i in.fq -o out.fq --disable_adapter_trimming
# Adapter FASTA file
fastp -i in.fq -o out.fq --adapter_fasta adapters.fa
Quality Filtering
# Per-base quality threshold (default Q15)
fastp -i in.fq -o out.fq -q 20
# Mean read quality threshold
fastp -i in.fq -o out.fq -e 25
# Max unqualified bases percent (default 40)
fastp -i in.fq -o out.fq -q 20 --unqualified_percent_limit 30
# Disable quality filtering
fastp -i in.fq -o out.fq --disable_quality_filtering
Quality Trimming
# Sliding window from 3' end (recommended)
fastp -i in.fq -o out.fq \
--cut_right \
--cut_right_window_size 4 \
--cut_right_mean_quality 20
# Sliding window from 5' end
fastp -i in.fq -o out.fq \
--cut_front \
--cut_front_window_size 4 \
--cut_front_mean_quality 20
# Both ends
fastp -i in.fq -o out.fq \
--cut_front --cut_tail \
--cut_front_window_size 4 \
--cut_front_mean_quality 20 \
--cut_tail_window_size 4 \
--cut_tail_mean_quality 20
Length Filtering
# Minimum length (default 15)
fastp -i in.fq -o out.fq -l 36
# Maximum length
fastp -i in.fq -o out.fq --length_limit 150
# Required length (discard shorter AND longer)
fastp -i in.fq -o out.fq -l 100 --length_limit 100
Poly-X Trimming
# Trim poly-G (NovaSeq/NextSeq artifacts) - auto-enabled for these platforms
fastp -i in.fq -o out.fq --trim_poly_g
# Disable poly-G trimming
fastp -i in.fq -o out.fq --disable_trim_poly_g
# Trim poly-X (any homopolymer)
fastp -i in.fq -o out.fq --trim_poly_x
# Custom poly-G minimum length (default 10)
fastp -i in.fq -o out.fq --trim_poly_g --poly_g_min_len 5
N Base Handling
# Max N bases (default 5)
fastp -i in.fq -o out.fq -n 3
# Disable N filtering
fastp -i in.fq -o out.fq --n_base_limit 50
Deduplication
# Enable deduplication
fastp -i in.fq -o out.fq --dedup
# Accuracy level (1-6, higher = more memory, default 3)
fastp -i in.fq -o out.fq --dedup --dup_calc_accuracy 4
Base Correction (Paired-End Only)
# Enable overlap-based correction
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq --correction
# Required overlap length (default 30)
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \
--correction --overlap_len_require 20
Paired-End Merge
# Merge overlapping paired reads
fastp -i R1.fq -I R2.fq \
--merge --merged_out merged.fq \
-o R1_unmerged.fq -O R2_unmerged.fq
UMI Processing
# UMI in read (extract to header)
fastp -i in.fq -o out.fq \
--umi --umi_loc read1 --umi_len 8
# UMI in separate read
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \
--umi --umi_loc index1
# UMI locations: index1, index2, read1, read2, per_index, per_read
Complete Workflow Example
Standard Illumina Pipeline
fastp \
-i raw_R1.fastq.gz -I raw_R2.fastq.gz \
-o clean_R1.fastq.gz -O clean_R2.fastq.gz \
--detect_adapter_for_pe \
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20 \
-q 20 -l 36 \
--thread 8 \
-h sample_fastp.html -j sample_fastp.json
NovaSeq/NextSeq Pipeline
fastp \
-i raw_R1.fastq.gz -I raw_R2.fastq.gz \
-o clean_R1.fastq.gz -O clean_R2.fastq.gz \
--detect_adapter_for_pe \
--trim_poly_g \
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20 \
-q 20 -l 36 \
--thread 8 \
-h sample_fastp.html -j sample_fastp.json
RNA-seq Pipeline
fastp \
-i raw_R1.fastq.gz -I raw_R2.fastq.gz \
-o clean_R1.fastq.gz -O clean_R2.fastq.gz \
--detect_adapter_for_pe \
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20 \
-q 20 -l 50 \
--thread 8 \
-h sample_fastp.html -j sample_fastp.json
Output Files
| File | Description |
|---|---|
*.html |
Interactive HTML report |
*.json |
Machine-readable statistics |
| Output FASTQ | Processed reads |
JSON Report Structure
import json
with open('sample_fastp.json') as f:
report = json.load(f)
summary = report['summary']
print(f"Total reads: {summary['before_filtering']['total_reads']}")
print(f"Passed reads: {summary['after_filtering']['total_reads']}")
print(f"Q20 rate: {summary['after_filtering']['q20_rate']:.2%}")
print(f"Q30 rate: {summary['after_filtering']['q30_rate']:.2%}")
Performance
# Set threads (default 3)
fastp -i in.fq -o out.fq --thread 8
# Disable HTML report (faster)
fastp -i in.fq -o out.fq --html /dev/null
# Process from stdin
zcat in.fq.gz | fastp --stdin -o out.fq
Related Skills
- quality-reports - MultiQC can aggregate fastp JSON reports
- adapter-trimming - Cutadapt for complex adapter scenarios
- quality-filtering - Trimmomatic alternative
More from gptomics/bioskills
bioskills
Installs 425 bioinformatics skills covering sequence analysis, RNA-seq, single-cell, variant calling, metagenomics, structural biology, and 56 more categories. Use when setting up bioinformatics capabilities or when a bioinformatics task requires specialized skills not yet installed.
100bio-single-cell-batch-integration
Integrate multiple scRNA-seq samples/batches using Harmony, scVI, Seurat anchors, and fastMNN. Remove technical variation while preserving biological differences. Use when integrating multiple scRNA-seq batches or datasets.
5bio-epitranscriptomics-merip-preprocessing
Align and QC MeRIP-seq IP and input samples for m6A analysis. Use when preparing MeRIP-seq data for peak calling or differential methylation analysis.
5bio-data-visualization-multipanel-figures
Combine multiple plots into publication-ready multi-panel figures using patchwork, cowplot, or matplotlib GridSpec with shared legends and panel labels. Use when combining multiple plots into publication figures.
5bio-data-visualization-specialized-omics-plots
Reusable plotting functions for common omics visualizations. Custom ggplot2/matplotlib implementations of volcano, MA, PCA, enrichment dotplots, boxplots, and survival curves. Use when creating volcano, MA, or enrichment plots.
5bio-data-visualization-genome-tracks
Create genome browser-style visualizations showing multiple data tracks (coverage, peaks, genes) using pyGenomeTracks, Gviz, and IGV. Use when visualizing genomic data at specific loci with multiple aligned tracks.
5