tooluniverse-sequence-retrieval
Biological Sequence Retrieval
Retrieve DNA, RNA, and protein sequences with proper disambiguation and cross-database handling.
IMPORTANT: Always use English terms in tool calls (gene names, organism names, sequence descriptions), even if the user writes in another language. Only try original-language terms as a fallback if English returns no results. Respond in the user's language.
Workflow Overview
Phase 0: Clarify (if needed)
↓
Phase 1: Disambiguate Gene/Organism
↓
Phase 2: Search & Retrieve (Internal)
↓
Phase 3: Report Sequence Profile
Phase 0: Clarification (When Needed)
Ask the user ONLY if:
- Gene name exists in multiple organisms (e.g., "BRCA1" → human or mouse?)
- Sequence type unclear (mRNA, genomic, protein?)
- Strain/isolate matters (e.g., E. coli → K-12, O157:H7, etc.)
Skip clarification for:
- Specific accession numbers (NC_, NM_, U*, etc.)
- Clear organism + gene combinations
- Complete genome requests with organism specified
Phase 1: Gene/Organism Disambiguation
1.1 Resolve Identifiers
from tooluniverse import ToolUniverse
tu = ToolUniverse()
tu.load_tools()
# Strategy depends on input type
if user_provided_accession:
# Direct retrieval based on accession type
accession = user_provided_accession
elif user_provided_gene_and_organism:
# Search NCBI Nucleotide
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism=organism,
gene=gene,
limit=10
)
1.2 Accession Type Decision Tree
CRITICAL: Accession prefix determines which tools to use.
| Prefix | Type | Use With |
|---|---|---|
| NC_* | RefSeq chromosome | NCBI only |
| NM_* | RefSeq mRNA | NCBI only |
| NR_* | RefSeq ncRNA | NCBI only |
| NP_* | RefSeq protein | NCBI only |
| XM_* | RefSeq predicted mRNA | NCBI only |
| U*, M*, K*, X* | GenBank | NCBI or ENA |
| CP*, NZ_* | GenBank genome | NCBI or ENA |
| EMBL format | EMBL | ENA preferred |
1.3 Identity Resolution Checklist
- Organism confirmed (scientific name)
- Gene symbol/name identified
- Sequence type determined (genomic/mRNA/protein)
- Strain specified (if relevant)
- Accession prefix identified → tool selection
Phase 2: Data Retrieval (Internal)
Retrieve silently. Do NOT narrate the search process.
2.1 Search for Sequences
# Search NCBI Nucleotide
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism=organism,
gene=gene,
strain=strain, # Optional
keywords=keywords, # Optional
seq_type=seq_type, # complete_genome, mrna, refseq
limit=10
)
# Get accession numbers from UIDs
accessions = tu.tools.NCBI_fetch_accessions(
operation="fetch_accession",
uids=result["data"]["uids"]
)
2.2 Retrieve Sequence Data
# Get sequence in desired format
sequence = tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession=accession,
format="fasta" # or "genbank"
)
# GenBank format for annotations
annotations = tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession=accession,
format="genbank"
)
2.3 ENA Alternative (for GenBank/EMBL accessions)
# Only for non-RefSeq accessions!
if not accession.startswith(("NC_", "NM_", "NR_", "NP_", "XM_", "XR_")):
# ENA entry info
entry = tu.tools.ena_get_entry(accession=accession)
# ENA FASTA
fasta = tu.tools.ena_get_sequence_fasta(accession=accession)
# ENA summary
summary = tu.tools.ena_get_entry_summary(accession=accession)
Fallback Chains
| Primary | Fallback | Notes |
|---|---|---|
| NCBI_get_sequence | ENA (if GenBank format) | NCBI unavailable |
| ENA_get_entry | NCBI_get_sequence | ENA doesn't have RefSeq |
| NCBI_search_nucleotide | Try broader keywords | No results |
Critical Rule: Never try ENA tools with RefSeq accessions (NC_, NM_, etc.) - they will return 404 errors.
Phase 3: Report Sequence Profile
Output Structure
Present as a Sequence Profile Report. Hide search process.
# Sequence Profile: [Gene/Organism]
**Search Summary**
- Query: [gene] in [organism]
- Database: NCBI Nucleotide
- Results: [N] sequences found
---
## Primary Sequence
### [Accession]: [Definition/Title]
| Attribute | Value |
|-----------|-------|
| **Accession** | [accession] |
| **Type** | RefSeq / GenBank |
| **Organism** | [scientific name] |
| **Strain** | [strain if applicable] |
| **Length** | [X,XXX bp / aa] |
| **Molecule** | DNA / mRNA / Protein |
| **Topology** | Linear / Circular |
**Curation Level**: ●●● RefSeq (curated) / ●●○ GenBank (submitted) / ●○○ Third-party
### Sequence Statistics
| Statistic | Value |
|-----------|-------|
| **Length** | [X,XXX] bp |
| **GC Content** | [XX.X]% |
| **Genes** | [N] (if genome) |
| **CDS** | [N] (if annotated) |
### Sequence Preview
```fasta
>[accession] [definition]
ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA
... [truncated, full sequence in download]
Annotations Summary (from GenBank format)
| Feature | Count | Examples |
|---|---|---|
| CDS | [N] | [gene names] |
| tRNA | [N] | - |
| rRNA | [N] | 16S, 23S |
| Regulatory | [N] | promoters |
Alternative Sequences
Ranked by relevance and curation level:
| Accession | Type | Length | Description | ENA Compatible |
|---|---|---|---|---|
| NC_000913.3 | RefSeq | 4.6 Mb | E. coli K-12 reference | ✗ |
| U00096.3 | GenBank | 4.6 Mb | E. coli K-12 | ✓ |
| CP001509.3 | GenBank | 4.6 Mb | E. coli DH10B | ✓ |
Cross-Database References
| Database | Accession | Link |
|---|---|---|
| RefSeq | [NC_*] | [NCBI link] |
| GenBank | [U*] | [NCBI link] |
| ENA/EMBL | [same as GenBank] | [ENA link] |
| BioProject | [PRJNA*] | [link] |
| BioSample | [SAMN*] | [link] |
Download Options
Formats Available
| Format | Description | Use Case |
|---|---|---|
| FASTA | Sequence only | BLAST, alignment |
| GenBank | Sequence + annotations | Gene analysis |
| GFF3 | Annotations only | Genome browsers |
Direct Commands
# FASTA format
tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession="[accession]",
format="fasta"
)
# GenBank format (with annotations)
tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession="[accession]",
format="genbank"
)
Related Sequences
Other Strains/Isolates
| Accession | Strain | Similarity | Notes |
|---|---|---|---|
| [acc1] | [strain1] | 99.9% | [notes] |
| [acc2] | [strain2] | 99.5% | [notes] |
Protein Products (if applicable)
| Protein Accession | Product Name | Length |
|---|---|---|
| [NP_*] | [protein name] | [X] aa |
Retrieved: [date] Database: NCBI Nucleotide
---
## Curation Level Tiers
| Tier | Symbol | Accession Prefix | Description |
|------|--------|------------------|-------------|
| RefSeq Reference | ●●●● | NC_, NM_, NP_ | NCBI-curated, gold standard |
| RefSeq Predicted | ●●●○ | XM_, XP_, XR_ | Computationally predicted |
| GenBank Validated | ●●○○ | Various | Submitted, some curation |
| GenBank Direct | ●○○○ | Various | Direct submission |
| Third Party | ○○○○ | TPA_ | Third-party annotation |
Include in report:
```markdown
**Curation Level**: ●●●● RefSeq Reference
- Curated by NCBI RefSeq project
- Regular updates and validation
- Recommended for reference use
Completeness Checklist
Every sequence report MUST include:
Per Sequence (Required)
- Accession number
- Organism (scientific name)
- Sequence type (DNA/RNA/protein)
- Length
- Curation level
- Database source
Search Summary (Required)
- Query parameters
- Number of results
- Ranking rationale
Include Even If Limited
- Alternative sequences (or "Only one sequence found")
- Cross-database references (or "No cross-references available")
- Download instructions
Common Use Cases
Reference Genome
User: "Get E. coli K-12 complete genome"
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism="Escherichia coli",
strain="K-12",
seq_type="complete_genome",
limit=3
)
# Return NC_000913.3 (RefSeq reference)
Gene Sequence
User: "Find human BRCA1 mRNA"
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism="Homo sapiens",
gene="BRCA1",
seq_type="mrna",
limit=10
)
Specific Accession
User: "Get sequence for NC_045512.2" → Direct retrieval with full metadata
Strain Comparison
User: "Compare E. coli K-12 and O157:H7 genomes" → Search both strains, provide comparison table
Error Handling
| Error | Response |
|---|---|
| "No search criteria provided" | Add organism, gene, or keywords |
| "ENA 404 error" | Accession is likely RefSeq → use NCBI only |
| "No results found" | Broaden search, check spelling, try synonyms |
| "Sequence too large" | Note size, provide download link instead of preview |
| "API rate limit" | Tools auto-retry; if persistent, wait briefly |
Tool Reference
NCBI Tools (All Accessions)
| Tool | Purpose |
|---|---|
NCBI_search_nucleotide |
Search by gene/organism |
NCBI_fetch_accessions |
Convert UIDs to accessions |
NCBI_get_sequence |
Retrieve sequence data |
ENA Tools (GenBank/EMBL Only)
| Tool | Purpose |
|---|---|
ena_get_entry |
Entry metadata |
ena_get_sequence_fasta |
FASTA sequence |
ena_get_entry_summary |
Summary info |
Search Parameters Reference
NCBI_search_nucleotide
| Parameter | Description | Example |
|---|---|---|
operation |
Always "search" | "search" |
organism |
Scientific name | "Homo sapiens" |
gene |
Gene symbol | "BRCA1" |
strain |
Specific strain | "K-12" |
keywords |
Free text | "complete genome" |
seq_type |
Sequence type | "complete_genome", "mrna", "refseq" |
limit |
Max results | 10 |
NCBI_get_sequence
| Parameter | Description | Example |
|---|---|---|
operation |
Always "fetch_sequence" | "fetch_sequence" |
accession |
Accession number | "NC_000913.3" |
format |
Output format | "fasta", "genbank" |
More from wu-yc/labclaw
tooluniverse-chemical-safety
Comprehensive chemical safety and toxicology assessment integrating ADMET-AI predictions, CTD toxicogenomics, FDA label safety data, DrugBank safety profiles, and STITCH chemical-protein interactions. Performs predictive toxicology (AMES, DILI, LD50, carcinogenicity), organ/system toxicity profiling, chemical-gene-disease relationship mapping, regulatory safety extraction, and environmental hazard assessment. Use when asked about chemical toxicity, drug safety profiling, ADMET properties, environmental health risks, chemical hazard assessment, or toxicogenomic analysis.
19rowan
Cloud-based quantum chemistry platform with Python API. Preferred for computational chemistry workflows including pKa prediction, geometry optimization, conformer searching, molecular property calculations, protein-ligand docking (AutoDock Vina), and AI protein cofolding (Chai-1, Boltz-1/2). Use when tasks involve quantum chemistry calculations, molecular property prediction, DFT or semiempirical methods, neural network potentials (AIMNet2), protein-ligand binding predictions, or automated computational chemistry pipelines. Provides cloud compute resources with no local setup required.
18tooluniverse-drug-repurposing
Identify drug repurposing candidates using ToolUniverse for target-based, compound-based, and disease-driven strategies. Searches existing drugs for new therapeutic indications by analyzing targets, bioactivity, safety profiles, and literature evidence. Use when exploring drug repurposing opportunities, finding new indications for approved drugs, or when users mention drug repositioning, off-label uses, or therapeutic alternatives.
18rdkit
Cheminformatics toolkit for fine-grained molecular control. SMILES/SDF parsing, descriptors (MW, LogP, TPSA), fingerprints, substructure search, 2D/3D generation, similarity, reactions. For standard workflows with simpler interface, use datamol (wrapper around RDKit). Use rdkit for advanced control, custom sanitization, specialized algorithms.
17tooluniverse-clinical-guidelines
Search and retrieve clinical practice guidelines across 12+ authoritative sources including NICE, WHO, ADA, AHA/ACC, NCCN, SIGN, CPIC, CMA, CTFPHC, GIN, MAGICapp, PubMed, EuropePMC, TRIP, and OpenAlex. Covers disease management, cardiology, oncology, diabetes, pharmacogenomics, and more. Use when users ask about clinical guidelines, treatment recommendations, standard of care, evidence-based medicine, or drug-gene dosing recommendations.
17tooluniverse-protein-therapeutic-design
Design novel protein therapeutics (binders, enzymes, scaffolds) using AI-guided de novo design. Uses RFdiffusion for backbone generation, ProteinMPNN for sequence design, ESMFold/AlphaFold2 for validation. Use when asked to design protein binders, therapeutic proteins, or engineer protein function.
17